|
biomers.net gmbh
fam-[d(agggagggcgctgggaggaggg)]-tamra sequence ( f-c-kit1-t Fam [D(Agggagggcgctgggaggaggg)] Tamra Sequence ( F C Kit1 T, supplied by biomers.net gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fam-[d(agggagggcgctgggaggaggg)]-tamra sequence ( f-c-kit1-t/product/biomers.net gmbh Average 90 stars, based on 1 article reviews
fam-[d(agggagggcgctgggaggaggg)]-tamra sequence ( f-c-kit1-t - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Oligos Etc
g4-dna c-kit1 G4 Dna C Kit1, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/g4-dna c-kit1/product/Oligos Etc Average 90 stars, based on 1 article reviews
g4-dna c-kit1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
fret oligonucleotides c-kit1 Fret Oligonucleotides C Kit1, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fret oligonucleotides c-kit1/product/Sangon Biotech Average 90 stars, based on 1 article reviews
fret oligonucleotides c-kit1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Becton Dickinson
c-kit1 (pe) lineage cocktail (v450 C Kit1 (Pe) Lineage Cocktail (V450, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c-kit1 (pe) lineage cocktail (v450/product/Becton Dickinson Average 90 stars, based on 1 article reviews
c-kit1 (pe) lineage cocktail (v450 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
c-kit1 g-quadruplex dna C Kit1 G Quadruplex Dna, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c-kit1 g-quadruplex dna/product/Sangon Biotech Average 90 stars, based on 1 article reviews
c-kit1 g-quadruplex dna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
annealed c-myc pu22, tta and c-kit1 g-quadruplex forming oligonucleotides labelled with 5′-cy5 Annealed C Myc Pu22, Tta And C Kit1 G Quadruplex Forming Oligonucleotides Labelled With 5′ Cy5, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/annealed c-myc pu22, tta and c-kit1 g-quadruplex forming oligonucleotides labelled with 5′-cy5/product/Thermo Fisher Average 90 stars, based on 1 article reviews
annealed c-myc pu22, tta and c-kit1 g-quadruplex forming oligonucleotides labelled with 5′-cy5 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Alphamed INC
c-kit1 cells C Kit1 Cells, supplied by Alphamed INC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c-kit1 cells/product/Alphamed INC Average 90 stars, based on 1 article reviews
c-kit1 cells - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
StemCells Inc
c-kit1 cells C Kit1 Cells, supplied by StemCells Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c-kit1 cells/product/StemCells Inc Average 90 stars, based on 1 article reviews
c-kit1 cells - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Miltenyi Biotec
c-kit1 magnetic beads C Kit1 Magnetic Beads, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c-kit1 magnetic beads/product/Miltenyi Biotec Average 90 stars, based on 1 article reviews
c-kit1 magnetic beads - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |